MCB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chicas, A.
Right arrow Articles by Macino, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chicas, A.
Right arrow Articles by Macino, G.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, May 2005, p. 3793-3801, Vol. 25, No. 9
0270-7306/05/$08.00+0     doi:10.1128/MCB.25.9.3793-3801.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Small Interfering RNAs That Trigger Posttranscriptional Gene Silencing Are Not Required for the Histone H3 Lys9 Methylation Necessary for Transgenic Tandem Repeat Stabilization in Neurospora crassa{dagger}

Agustin Chicas,{ddagger} Emma C. Forrest, Silvia Sepich, Carlo Cogoni, and Giuseppe Macino*

Istituto Pasteur e Fondazione Cenci Bolognetti, Dipartimento di Biotecnologie Cellulari ed Ematologia, Sezione di Genetica Molecolare, Universita di Roma "La Sapienza," Viale Regina Elena, 324, 00161 Roma, Italy

Received 5 August 2004/ Returned for modification 20 September 2004/ Accepted 1 February 2005


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In Neurospora crassa, the introduction of a transgene can lead to small interfering RNA (siRNA)-mediated posttranscriptional gene silencing (PTGS) of homologous genes. siRNAs can also guide locus-specific methylation of Lys9 of histone H3 (Lys9H3) in Schizosaccharomyces pombe. Here we tested the hypothesis that transgenically derived siRNAs may contemporaneously both activate the PTGS mechanism and induce chromatin modifications at the transgene and the homologous endogenous gene. We carried out chromatin immunoprecipitation using a previously characterized albino-1 (al-1) silenced strain but detected no alterations in the pattern of histone modifications at the endogenous al-1 locus, suggesting that siRNAs produced from the transgenic locus do not trigger modifications in trans of those histones tested. Instead, we found that the transgenic locus was hypermethylated at Lys9H3 in our silenced strain and remained hypermethylated in the quelling defective mutants (qde), further demonstrating that the PTGS machinery is dispensable for Lys9H3 methylation. However, we found that a mutant in the histone Lys9H3 methyltransferase dim-5 was unable to maintain PTGS, with transgenic copies being rapidly lost, resulting in reversion of the silenced phenotype. These results indicate that the defect in PTGS of the {Delta}dim-5 strain is due to the inability to maintain the transgene in tandem, suggesting a role for DIM-5 in stabilizing such repeated sequences. We conclude that in Neurospora, siRNAs produced from the transgenic locus are used in the RNA-induced silencing complex-mediated PTGS pathway and do not communicate with an RNAi-induced initiation of transcriptional gene silencing complex to effect chromatin-based silencing.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In an attempt to overexpress genes, scientists working with both plants and fungi have uncovered mechanisms that these organisms use to protect their genome against invading DNA (6). Foreign DNA is generally inactivated through silencing. Inactivation of the invading nucleic acid often leads to silencing of all homologous sequences, including endogenous genes, and this inactivation can take place at the transcriptional or posttranscriptional level (7). Inactivation at the posttranscriptional level has been detected in plants, where it is called cosuppression (30), fungi, where it is called quelling (37), and animals, where it is called RNA interference (RNAi) and is triggered by the introduction of double-stranded RNA (16). We have shown that in Neurospora crassa the introduction of an albino-1 (al-1) transgene can lead to posttranscriptional silencing of the endogenous al-1 gene (8). The al-1 gene encodes an enzyme involved in carotenoid biosynthesis, a pigment that gives Neurospora its characteristic orange color. Silencing of the al-1 gene can therefore be easily monitored as quelled transformants become albino. The silenced phenotype, which is found in 20 to 40% of transformants, is transmitted through mitosis and tightly correlates with the presence of tandemly integrated transgenes (12). In a screen for posttranscriptional gene silencing (PTGS)-defective mutants, we identified three genetic loci that are required for PTGS (10): an RNA-dependent RNA polymerase (QDE-1) (9), a member of the Piwi Paz domain (PPD) family of proteins (QDE-2) (3), and a protein of the RecQ helicase family (QDE-3) (11). Recently we have shown, using a reverse genetic approach, that Dicer activity is also required for PTGS (5). Characterization of these loci has given a great wealth of information about the mechanism of posttranscriptional gene silencing.

Efforts to elucidate the mechanism of posttranscriptional gene silencing have revealed that it is commonly conserved among organisms. Fungi, like plants and animals, require the RNase III-type enzyme Dicer (5) and proteins of the PPD family (3). Plants and fungi also require the presence of an RNA-dependent RNA polymerase (9, 14, 28) in transgene-induced silencing, presumably creating double-stranded RNA (dsRNA) from the single-stranded-RNA template to be used as a target for Dicer. Dicer has been shown to cleave long dsRNAs into 21-23 small interfering RNAs (siRNAs) (2), which, in conjunction with the proteins of the PPD family, make up the RNA-induced silencing complex (RISC) that degrades the native mRNA (21).

siRNAs have been found to be involved not only in PTGS by targeting sequence-specific RNA degradation but also in silencing genes at the transcriptional level by inducing locus-specific epigenetic changes. The first evidence of an RNA-directed epigenetic change was provided in tobacco plants in which viroids that have dsRNA replication intermediates were able to induce methylation of homologous nuclear DNA sequences (44). Subsequently, it was found that dsRNA directed against a promoter sequence could induce DNA methylation and block transcription of the associated gene (26). A clear example that siRNAs can work in trans came from work with Schizosaccharomyces pombe, where siRNAs derived from the processing of a dsRNA expressed from a transgenic inverted repeat were able to induce chromatin modifications and transcriptional silencing of a unlinked homologous sequence (38). Components of the RNAi machinery, such as RNA-dependent RNA polymerase, Ago1, and Dicer, were shown to be necessary for the formation of proper heterochromatin structure, confirming the link between the siRNA-mediated silencing pathway and heterochromatin. Moreover, the identification of an RNA-induced initiation of transcriptional gene silencing (RITS) complex that binds, in a siRNA-directed fashion, to centromeric heterochromatin further elucidates the molecular basis of transcriptional silencing mediated by siRNAs (41). Studies have shown that plants possess a similar system to mediate chromatin changes. Zilberman et al. found that a PPD family protein, Ago4, and siRNAs were required to direct methylation of Lys9H3 at a transposon locus (45). The requirement of components of the RNAi machinery in directing locus-specific Lys9H3 methylation has also been demonstrated with Drosophila (34) and Tetrahymena (25). Together these studies point to the existence of a conserved mechanism in eukaryotes that uses siRNAs in conjunction with a RITS complex to direct epigenetic modifications.

Although it is clear that the RNAi machinery can be devoted to direct epigenetic modifications and eventually transcriptional gene silencing, another line of evidence suggests that chromatin modifications may themselves be important in activating and/or maintaining PTGS. In fact, in Arabidopsis, mutations in either a SWI2/SNF2 chromatin component (DDM1) or the major DNA methyltransferase (MET1) resulted in the release of PTGS (27). Thus, a self-reinforcing model may be proposed in which chromatin modifications activate the production of siRNAs that in turn contribute to maintaining and reinforcing such modifications.

With Neurospora crassa, we have previously demonstrated that a tandem transgenic repeat is the source of siRNAs that have been shown to induce the degradation of a homologous endogenous mRNA (4). Here, we have tested the hypothesis that the production of transgenic siRNAs may simultaneously activate both a PTGS mechanism and induce modifications of histones at both the transgene al-1 and endogenous al-1 loci. We carried out chromatin immunoprecipitation (ChIP) using different antibodies against specific histone modifications but detected no alterations in the pattern of histone modifications at the endogenous al-1 locus, suggesting that siRNAs produced from the transgenic locus do not trigger modifications in trans of those histones tested. We analyzed the chromatin status of the transgene and found that the transgenic locus was hypermethylated at Lys9 of histone H3 (Lys9H3). To evaluate the possible role of this hypermethylation in the activation and maintenance of PTGS, we knocked out the dim-5 gene, which encodes the Neurospora Lys9H3 methyltransferase. While the dim-5 mutants were able to establish PTGS, albeit at a much-reduced efficiency, they were unable to maintain it, with transgenic copies being rapidly lost, resulting in reversion of the silenced phenotype. These results indicate that the defect in PTGS of the {Delta}dim-5 strain is due to the inability to maintain the tandemly organized transgene.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ChIP. Chromatin immunoprecipitations (ChIP) were carried out as described previously (33), with modifications. Conidia (108) were inoculated in Neurospora minimal medium and grown for 24 h. The mycelia were fixed in 2.5% formaldehyde for 10 min, filtered, and washed with cold 1x phosphate-buffered saline (PBS). One milligram of dry mycelium was sonicated in 5 ml of 10 mM Tris (pH 8)-1 mM EDTA (pH 7.5)-0.5 mM EGTA (pH 7.5) and 1 ml of glass beads for 10 pulses of 30 s each with 30 s resting. The insoluble debris was pelleted by centrifugation, and the chromatin in the supernatant was obtained by CsCl ultracentrifugation as described previously (33). Fractions with a density between 1.35 and 1.45 were pooled, dialyzed, and stored at –20°C. A fraction of chromatin was reverse cross-linked to determine the concentration of DNA (referred to as input DNA from here on in). The equivalent of 15 µg of chromatin was used for immunoprecipitation (IP) with the different antibodies as described below. DNA was resuspended in 100 µl of H2O (referred to as "IP chromatin" from here on in), and 2 µl was used for the PCR. Antibodies used were as follows: anti-nonacetylated H3 (Upstate), anti-histone H3 acetylated in Lys9/Lys14 (Upstate), anti-histone H3 trimethylated in Lys4 (Abcam), anti-tetra-acetylated H4 (Upstate), anti-histone H4 acetylated in Lys8 (Upstate), anti-histone H3 trimethylated Lys9 (three different antibodies were tested; one was a gift from Prim Singh [13], one was purchased from AbCAM, and the third was a gift from T. Jenuwein [35]), and anti-histone H3 trimethylated in Lys27 (gift from T. Jenuwein). For each immunoprecipitation, a control without antibody was performed (referred to as "mock" from here on in).

Quantification of immunoprecipitated DNA. Quantification was performed using a real-time PCR machine, LightCycler (Roche), with FastStart DNA Master SYBR green 1 kit (Roche). Data were analyzed with built-in LightCycler software, version 3.01, using the second derivative method for determining the crossing point (Cp) value for each sample.

The primers used for quantitative PCR were as follows. P1, 5' CACTAAAGGGAACAAAAGCTGGA 3'; P2, 5' TCTTTTCGAGAACTGTGACGTCTAC 3'; P3, 5' TGAAGTCGTTCTTTTCGAGAACTG 3'; P4, 5' GCGCGCAATTAACCCTCAC 3'; P5, 5' ACC GAT TCA CGA CCC TCT CTT 3'; P6, 5' CGG AGA CGG CAT CAT CAC A 3'; Wc1 upper, 5' TCAACATCTTCCGCCTCATCTC 3'; Wc1 lower, 5' ATGCTGCTGATGCTGCTTATGC 3'.

Transgenic DNA was amplified using the primer P2 derived from the bacterial vector sequence and the primer P1 from the al-1 transgene to avoid amplification of the endogenous al-1 gene DNA. The primers for the endogenous al-1 gene (P5 and P6) were derived from a 5' region not included in the transgene to avoid amplification of transgenic al-1 DNA (see Fig. 1D). The white collar (wc-1) primers are derived from the 3' region of the wc-1 gene. Primers were designed to give products between 80 and 110 bp and were empirically tested to make sure they did not produce primer-primer dimers.



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 1. Lys9H3 hypermethylation of the transgenic but not the endogenous al-1 loci. ChIP analysis showed that (A) there was no enrichment in immunoprecipitated endogenous al-1 DNA using the following antibodies: H3, nonacetylated H3; AK9/K14H3, histone H3 acetylated in Lys9/Lys14; 3mK4H3, trimethylated in Lys4; Tetra AH4, tetra-acetylated H4; AK8H4, histone H4 acetylated in Lys8; 3mK9H3, trimethylated in Lys9; 3mK27H3, trimethylated in Lys27. (B) Instead, the transgenic al-1 locus shows a sixfold enrichment of Lys9H3 methylation. The error bars represent the standard deviation of one IP analyzed in triplicate. (C) RT-PCR analysis to detect transgenic transcripts. Reverse transcription was carried out with either the RTSS or RTAS primers, which are immediately upstream of P1 and P2, respectively. One-tenth of the RT reaction volume was used for the PCRs, which were done using the P1-P2 primer pair. The PCR products were run on a 2% agarose gel and visualized by ethidium bromide staining. (D) Schematic diagram of the al-1 transgenic locus compared to the endogenous al-1 gene depicting the position of the different primers used for quantitative PCR. Thick shadow regions represent the al-1 coding regions, the clear areas represent the introns of the al-1 gene, and the solid lines represent the vector sequences. A primer derived from the bacterial vector sequence (P2) and the other from the al-1 gene (P1) were used to detect al-1 transgene-specific amplicons of 89 bp.

 
Chromatin IPs are known to give high background signal. To correct for this, we carried out mock IPs (no antibody) for every chromatin preparation. Before subjecting the IPs to quantification, the efficiency of the IP was determined by calculating the enrichment of DNA immunoprecipitated over the mock IP (background) (see Tables S1 and S2 in the supplemental material). Antibody IPs that showed less than a fivefold enrichment over background were discarded. The concentration of IP chromatin was compared with a standard curve generated from input DNA. The PCRs for the IPs and the standard curve for a given set of primers were always carried out simultaneously. PCRs for each IP were carried out in triplicate to correct for pipetting error. Because the efficiency of the immunoprecipitation can vary from antibody to antibody and from sample to sample, variations in sample quantities were normalized by dividing the values obtained for the target DNA (transgene or endogenous al-1 gene) by the values obtained for the reference gene (wc-1) from the same sample. It is important to point out that the fold enrichment values are internally corrected for copy number. This is because the standard curve used to determine the amount of transgenic DNA in the IPs is derived from the amplification of input DNA from the transgenic strain 6xw, containing about 25 copies of the transgene (8). Consequently, given that the efficiencies for the wc-1 and transgene oligonucleotides were comparable, the standard curve resulting from the transgene amplification was vertically shifted (about 4.5 Cp units) with respect to that resulting from wc-1 amplification, showing that the same amount of input DNA gave a detectable signal for the single-copy wc-1 about 4.5 cycles later than it does for transgenic DNA. This 4.5-cycle difference is reasonable and, assuming an amplification efficiency of 2, reflects a 24.5 = 22.6-fold difference. In Fig. S3 of the supplemental material, an example to clarify this point is shown: the two standard curves obtained for wc-1 and the transgene are shown in graphical form, and data of a representative amplification of IP chromatin from a 6xw strain are plotted on the graph. In the same graph, the result obtained for a sample displaying no enrichment is shown.

Western blot analysis of protein. Tissue was ground in liquid nitrogen with a mortar and pestle and suspended in ice-cold lysis buffer (50 mM HEPES [pH 7.4], 137 mM KCl, 10% glycerol containing 1 mM phenylmethylsulfonyl fluoride, 1 mM EDTA, 1 mM leupeptin, 1 mM pepstatin A) at a ratio of 0.5 ml of buffer to 0.1 g of tissue. Extracts were homogenized by three strokes of a Teflon/glass homogenizer, and cellular debris was removed by centrifugation at 10,000 x g. The protein concentration of the supernatant was determined with the Bio-Rad reagent according to the manufacturer's instructions. Equal quantities of proteins (100 µg) for different extracts were denatured in Laemmli sample buffer and separated by 15% SDS-PAGE. After transfer to nitrocellulose (Amersham), blots were incubated with either anti-trimethyl Lys9H3 or anti-trimethyl Lys4H3 antibodies. Horseradish peroxidase-conjugated anti-rabbit immunoglobulin G was used as a secondary antibody (Bio-Rad), and Western blots were developed using chemiluminescence (ECL; Amersham).

RT and quantitative PCR. Reverse transcription (RT) was done with SuperScript II H- Reverse transcriptase (Invitrogen) according to the manufacturer's conditions except as follows: the amount of total RNA was 5 µg, and the amount of gene-specific primer was 2 pmol. Reverse transcription was carried out with either the RTSS (AGT GAG CGC GCG TAA TAC GA) or RTAS (CAA GGA GTC CTT TGA CGC TA) primers, which are immediately upstream of P1 and P2, respectively. One-tenth of the RT reaction volume was used for the PCRs, which were performed using the P1-P2 primer pair. The PCR products were run on a 2% agarose gel and visualized by ethidium bromide staining. We also quantified the PCR products by real-time PCR using Roche's FastStart DNA Master SYBR green 1 kit. The quantification was done using an external standard curve made with a serial dilution of one of the RT reactions. The efficiency of reverse transcription among different samples was normalized by including an actin-specific primer in all RT reactions and quantifying the amount of actin RNA.

Neurospora crassa strains, media, and growth conditions. Strains were grown in Vogel's minimal medium for Neurospora in the presence of appropriate nutritional supplements and/or selectable markers. Preparation of N. crassa spheroplasts and transformation with recombinant plasmids were performed as reported by Vollmer and Yanofsky (42). The stably silenced strain (6xw) was previously described (8), as were the qde mutant strains (10). Strains 74-OR23A (FGSC no. 987) and 74-OR8a (FGSC no. 988) were obtained from the Fungal Genetics Stock Center, University of Kansas, Kansas City, Kansas.

Purification by microconidia. Since Neurospora is a multinucleate syncytial organism, in order to ensure that all strains were homokaryotic, we purified it by isolation of microconidia as described in reference 15.

Isolation of the {Delta}dim-5 strain. To obtain a {Delta}dim-5 strain, we performed site-specific insertional mutagenesis by transforming spheroplasts of the 6xw strain with a linear DNA fragment containing two sequences homologous to the upstream and downstream regions of the dim-5 genomic locus on either side of a hygromycin resistance cassette. The deleted strains have the gene for hygromycin resistance in place of the dim-5 coding region. Proper integration of the construct was confirmed by Southern blot analyses of hygromycin-resistant colonies (data not shown). In brief, genomic DNA preparations from hygromycin-resistant colonies were digested with SpeI and hybridized with a DNA 32P-labeled probe corresponding to the genomic region upstream of the 5' region used to direct recombination at the dim-5 locus. The absence of unique SpeI sites in the endogenous, nondisrupted dim-5 gene and the presence of SpeI in the hygromycin cassette of the replacement construct allowed the recombinant strains to be distinguished from the wild type (WT). The recombinant strain displaying the correct hybridization pattern was then purified by microconidia (15). In order to produce a {Delta}dim-5 mutant, allowing us to test for the ability to initiate silencing, we crossed the 6xw {Delta}dim-5 strain to remove the transgenic al-1 copies (either by chromosomal rearrangements or through repeat-induced point mutation [RIP], which efficiently mutates G:C to A:T). We crossed the 6xw {Delta}dim-5 strain with wild-type (WT) 74-OR23A (FGSC no. 987), and resulting ascospores were selected for nonsilenced, dim-5{Delta}; qa-2; aro-9, by their ability to grow on plates containing hygromycin and supplemented with a mixture of aromatic amino acids. The activity of either the enzyme ARO-9 or QA-2 is required for the biosynthesis of aromatic amino acids. The {Delta}dim-5 qa-2; aro-9 strain, once transformed with the plasmid pX16, which contains the al-1 transgene, can grow without the aromatic acids, since the vector also contains the gene encoding qa-2. Expression of QA-2 is sufficient to allow growth in minimal media.

Plasmid constructions. PCR amplification of wild-type N. crassa DNA was carried out using Taq DNA polymerase (Promega) with pairs of forward and reverse primers for upstream and downstream regions of the dim-5 locus. Forward and reverse primers for the upstream dim-5 region contained KpnI and XhoI restriction sites, respectively, whereas forward and reverse primers for its downstream region contained SpeI and NotI sites. The following primers were used: Dim5 forward upstream arm, 5'-GGC GGG GTA CCT GAA AAT GGT GCA CCA GG-3'; Dim5 reverse upstream arm, 5'-CCG CTC GAG ACG CTT TCT CCA TCT TGG-3'; Dim5 forward downstream arm, 5'-GGA CTA GTG GGG GAA GAT GTT AAC TC-3'; and Dim5 reverse downstream arm, 5'-AAG GAA AAA AGC GGC CGC GAT GTT TCC CCT GAA TGG-3'.

The PCR products were gel purified and digested with the appropriate enzymes, and both upstream and downstream fragments for a single locus were ligated into plasmid pCSN44 (39) to place a fragment on each side of the hygromycin resistance expression cassette. This plasmid was linearized by digestion with KpnI/NotI and purified by phenol-chloroform extraction and ethanol precipitation.

Southern blot. To identify knockout strains, five micrograms of chromosomal DNA digested with SpeI was fractionated by electrophoresis on a 0.8% agarose gel. The DNA was transferred onto GeneScreenPlus (NEN) filters by capillary blotting. Filters were prehybridized and hybridized at 65°C according to GeneScreenPlus procedures. The 32P-labeled probes used were prepared using a random-primed DNA labeling kit (Roche) as described by the manufacturer. The probe for the knock out was 500 bp long and synthesized by PCR amplification with 21-mer oligonucleotides from chromosomal DNA. The used primers were as follows: Dim5 forward probe, 5'-CGA CTA TCT ACC TAC CTA TCC-3'; Dim5 reverse probe, 5'-TAT GTT GGG AGA GGT TTC GGG-3'. For detection of the al-1 transgene instead, a labeled 1.3-kb XbaI/ClaI fragment of the al-1 gene, able to detect both endogenous and transgenic al-1 sequences, was used. Probes were 32P labeled using a random-primed DNA labeling kit (Roche) as described by the manufacturer.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Analysis of histone modifications at the endogenous locus. Introduction of an al-1 transgene can lead to posttranscriptional gene silencing of the endogenous al-1 gene (37). We have previously characterized a stably silenced strain (6xw) that produces siRNAs derived from the tandemly integrated al-1 transgene (4). To test if these siRNAs were able to induce chromatin modifications in trans at the endogenous locus, we carried out ChIP using a battery of antibodies (see Materials and Methods) able to recognize modifications of histones at specific residues, followed by quantitative PCR. In this assay, the amount of immunoprecipitated DNA gives an indication of the status of histones at a particular locus. Chromatin was prepared from the 6xw strain, and the amount of endogenous al-1 DNA immunoprecipitated was compared to that of the endogenous gene wc-1 (see Materials and Methods for more detail). Amplification of the endogenous al-1 gene was carried out with the primer pair P5 and P6 (Fig. 1D), which were derived from a 5' region of the al-1 gene not present in the transgene to avoid amplification of transgenic al-1 DNA. We detected no enrichment in immunoprecipitated endogenous al-1 DNA with any of the antibodies used (Fig. 1A), indicating that the transgenic siRNAs do not trigger modifications in trans of those histones tested.

Analysis of histone modifications at the transgenic locus. Factors that affect chromatin structure have been shown to be important to activate and/or maintain PTGS in plants (27); we therefore examined the chromatin structure of the transgenic locus in the 6xw strain. We previously calculated that this strain has 25 copies of the plasmid containing the transgene organized in a head-to-tail manner (8). Transgenic DNA was amplified using a primer derived from the bacterial vector sequence (P2) and the other from the al-1 transgene (P1) to avoid amplification of the endogenous al-1 gene DNA (see Fig. 1D). The amount of transgenic al-1 DNA immunoprecipitated with a battery of antibodies was compared to the amount of the single endogenous wc-1 DNA immunoprecipitated in the same IP. We found a sixfold enrichment in transgenic DNA immunoprecipitated with an antibody that recognizes trimethylated Lys9H3 (Fig. 1B). Since we cannot distinguish one transgenic copy from another across the tandemly repeated region, this enrichment is the average level of Lys9H3 methylation across the region. It is important to point out that the fold enrichment values are internally corrected for copy number (see Materials and Methods for details). In addition, a fivefold reduction in transgenic DNA immunoprecipitated with the anti-acetyl H3-Lys9/Lys14 was detected. Hypermethylation of Lys9H3 and hypomethylation of Lys4H3 have been found associated with heterochromatin (31), while hypermethylation of Lys4H3 has been found associated mainly with active chromatin (1, 32). As shown in Fig. 1B, we found no alteration of Lys4H3 methylation with respect to the endogenous wc-1 control. Previous results indicated that the transgenic locus was transcribed in sense polarity, suggesting that the hypermethylation of Lys9H3 does not completely block transcription (8). Here we show by using RT-PCR that the transgenic locus is transcribed in both sense and antisense orientations (Fig. 1C), albeit at a low level.

The role of the PTGS machinery in Lys9H3 methylation. Following the finding that the transgenic locus was hypermethylated in Lys9H3, we asked whether the PTGS machinery was required for the formation or maintenance of this heterochromatic state at the transgenic locus. If the siRNAs are functioning in cis in a feedback loop to facilitate binding of chromatin complexes, we may expect a change in the level of hypermethylation of Lys9H3 in the absence of the PTGS machinery. We therefore prepared chromatin from the different qde mutants and carried out immunoprecipitations with the antibody that recognizes trimethylated Lys9H3. No significant changes in Lys9H3 methylation of the transgenic (Fig. 2A) or endogenous (Fig. 2B) locus were observed in the qde mutants or in a revertant strain. The latter is a strain that has lost the silenced phenotype due to the loss of 80% of transgenic copies (10). These results indicate that the hypermethylation of Lys9H3 at the transgenic locus does not require the function of the qde genes.



View larger version (36K):
[in this window]
[in a new window]
 
FIG. 2. Analysis of Lys9H3 methylation at both transgenic (A) and endogenous (B) loci in the different PTGS-defective (qde) mutants. 6xw is the stably silenced parental strain (10). The genes involved in the PTGS pathway were found through mutagenesis and are as follows: qde-1 is the RNA-dependent RNA polymerase mutant (9), qde-2 is the PPD protein mutant (3), and qde-3 is the putative RecQ helicase mutant (11). The dim-5 mutant knocked out in the 6xw background (see Materials and Methods) and was included as a control. The revertant strain is one that is no longer silenced due to loss of 80% of transgenic copies (10). The error bars represent the standard deviation for two different immunoprecipitations analyzed in duplicate. We used three different antibodies for H3 trimethylated in Lys9; one was a gift from Prim Singh, one was purchased from AbCAM, and the third was a gift from Thomas Jenuwein. All antibodies gave similar results.

 
Requirement of DIM-5 in maintenance of PTGS. The observation that the transgenic locus is hypermethylated in Lys9H3 led us to ask if this modification played a role in the activation or maintenance of PTGS. The histone methyltransferase DIM-5 has been shown to specifically methylate Lys9 of histone H3 in Neurospora crassa (40). We therefore deleted dim-5 in the silenced 6xw strain in order to analyze the requirement of DIM-5 in the maintenance of PTGS. A knockout was created by homologous recombination by inserting the gene encoding hygromycin resistance in place of the dim-5 coding region. Proper integration of the construct was confirmed by Southern blot analyses of hygromycin-resistant colonies (data not shown). The {Delta}dim-5 strains were further characterized by Western blot analysis of a crude protein extract using an anti-trimethyl Lys9H3 antibody. We observed a significant reduction in Lys9H3 methylation in the {Delta}dim-5 strain (Fig. 3A), indicating that as previously demonstrated, dim-5 is the major if not the only enzyme required for Lys9H3 methylation (40). DIM-5 has been shown to be indirectly required for DNA methylation of duplicate sequences mutated by RIP in Neurospora (40). We have previously shown that the al-1 transgene is heavily DNA methylated (8). We therefore examined whether DNA methylation of the transgene was affected in the {Delta}dim-5 strain. Southern blot analysis of genomic DNA digested with either Sau3AI, which is inhibited by cytosine methylation, or the cytosine methylation-insensitive isoschizomer DpnII shows that DNA methylation of the transgene is lost in the {Delta}dim-5 strain (Fig. 3B). This result indicates that DIM-5 is also required for DNA methylation of non-RIP repeated sequences.



View larger version (36K):
[in this window]
[in a new window]
 
FIG. 3. Characterization of the {Delta}dim-5 strain. (A) Western blot analysis showing a reduction in Lys9H3 methylation in the {Delta}dim-5 strain. (B) Southern blot showing loss of transgene methylation in the {Delta}dim-5 strain. Genomic DNA from the parental 6xw strain or the {Delta}dim-5 strain was digested with either Sau3AI (S), which is inhibited by cytosine methylation, or the cytosine methylation-insensitive isoschizomer DpnII (D). The probe used detects an endogenous al-1 product of 521 bases (lane 2) and a transgene product of 583 bases (lane 1). The restriction site that gives the transgene product of 583 bases is methylated in the 6xw strain and hence is not cut efficiently by Sau3AI. This is shown by the reduction in the 583-base band and an increase in higher-molecular-weight bands.

 
The removal of dim-5 in the silenced strain (6xw) did not immediately affect PTGS of the al-1 gene; however, we noted that transformants rapidly lost their albino silenced phenotype. It is known that PTGS is generally an unstable process, with up to 30% of silenced transformants reverting to a WT nonsilenced phenotype (orange) (37). This reversion is associated with a loss of copies integrated in tandem (12). We therefore compared the stability of PTGS in the {Delta}dim-5 strains to a silenced strain with an intact dim-5 gene. We plated conidia (vegetative spores) from the {Delta}dim-5 silenced strains and the control dim-5+ quelled strain, picked individual colonies, and scored by visual inspection for the albino phenotype. Loss of the albino phenotype (so-called "revertant") was observed in less than 1% of the colonies in our control. In the {Delta}dim-5 strain, loss of the albino phenotype was seen in more than 70% of colonies analyzed. The remaining silenced colonies lost the albino phenotype in subsequent generations (Fig. 4B). This result indicates that Lys9H3 methylation may play a role in the maintenance of PTGS. We then examined if the loss of the albino phenotype in the {Delta}dim-5 strain was due to the loss of transgene copies by analyzing the transgenic copy number in the revertant strains by Southern blot analysis. Genomic DNA was digested with SmaI and HindIII, which cut in the endogenous al-1 locus to give a 3.1-kb band. The transgenic locus gives a band of 5.5 kb as it is cut only by SmaI and not by HindIII. Figure 4A shows that all revertants (lanes 1 to 10) have lost copies of the transgene compared to colonies that were still silenced (lanes 12 to 13) or the parental strain, 6xw (lane 11). We also analyzed those {Delta}dim-5 colonies that were still white but reverted to a nonsilenced phenotype in subsequent passages and found that they progressively lost transgenic copies when colonies were propagated by vegetative growth (Fig. 4B). These data suggest that DIM-5 affects the maintenance of PTGS in Neurospora by stabilizing transgenes integrated in tandem.



View larger version (79K):
[in this window]
[in a new window]
 
FIG. 4. Southern blots showing the instability of the transgene in the {Delta}dim-5 strain. (A) Revertants show loss of copies of the transgene. Genomic DNAs of 10 revertants (lanes 1 to 10), 2 silenced (S) (12 to 13), and the parental (P) strain (11) were digested with SmaI and HindIII, which cut in the endogenous al-1 locus to give a 3.1-kb band using the appropriate probe. Using this same probe, the transgenic locus gives a band of 5.5 kb because it is only cut by SmaI. In some strains, the transgenic bands are weaker than the endogenous band, since in this analysis the strains were not purified by microconidia (see Materials and Methods), so that some nuclei have completely lost transgenic copies whereas others maintain them. (B) Remaining silenced transformants progressively lost the al-1 transgene in the {Delta}dim-5 strain. Genomic DNA was extracted from mycelia grown for 20 (II), 30 (III), 40 (IV), and 50 (V) generations from both the {Delta}dim-5 strain and the parental strain (6xw), respectively, and digested as indicated in panel A. Loss of transgenic copies are represented in graphic form, using the PhosphorImager to measure the intensity of the bands normalized against the endogenous 3.1-kb band. (C) When {Delta}dim-5 was transformed with the fragment of al-1 (pX16), PTGS occurred in 6% of transformants, represented in this blot as D5 al-1 S (silenced). The transformants were analyzed for copy number and found to contain transgenes in tandem. WT al-1 S (silenced) transformants are shown as a control. Transformants marked 1 or 2 were analyzed for stability in panel D. (D) In the {Delta}dim-5 mutant strains (D5-1, D5-2), transgenic copies are lost in subsequent passages, whereas the WT al-1 silenced (WT-1, WT-2) control maintained the transgenic tandem. II and IV represent about 20 and 40 generations, respectively.

 
dim-5 is not required for the activation of PTGS. We then examined whether Lys9H3 methylation played a role in the initiation of PTGS. To test this hypothesis, we crossed the {Delta}dim-5 strain derived from the 6xw strain to a wild-type strain (WT {Delta}dim-5) (see Materials and Methods). Spheroplasts from this strain were then transformed with the plasmid pX16, which contains a fragment of the al-1 gene (8), and the plasmid pIR, which contains an inverted repeat of the al-1 gene that directly expresses dsRNA. We have recently shown that this construct (pIR) induces silencing of the al-1 gene (showing an albino phenotype) with 80% efficiency in a wild-type strain and that pIR bypasses the function of the qde-1 and qde-3 genes, confirming their requirement upstream of the production of the dsRNA (19). These transformants were also shown to be highly stable, with less than 1% reverting to a wild-type phenotype. Transformation of pIR into the WT {Delta}dim-5 strain resulted in 77% silencing (out of 100 transformants analyzed), indicating that dim-5 is not required for steps downstream of the synthesis of the dsRNA, i.e., the production of siRNAs. This is contrary to results seen in S. pombe, where the Lys9H3 methyltransferase clr-4 is required for the efficient production of siRNAs from dsRNA (38). Instead, when we transformed the transgenic albino-1 pX16 into the WT {Delta}dim-5 strain, only 6% (from 300 analyzed) of transformants showed an albino phenotype compared to the 20 to 40% usually found in the wild-type strain. The presence of silenced transformants indicates that dim-5 is not required for the activation of PTGS. Because DIM-5 appeared to be required to stabilize the transgenic locus, we analyzed the {Delta}dim-5 al-1 transformants by Southern blotting in order to determine the transgenic copy number. We observed that all nonsilenced strains analyzed had a very few copies of the transgene (data not shown) and that the residual silenced transformants had copies inserted in tandem (Fig. 4C). However, these transformants rapidly reverted to a WT phenotype. As we had previously observed with the 6xw strain deleted in dim-5, this reversion was associated with loss of transgenic copies in tandem (Fig. 4D). On the contrary, WT transformants containing the al-1 transgene maintained copies in tandem (Fig. 4D). These data support the idea that the reduction in PTGS efficiency is due to a rapid loss of transgenic DNA following integration.


    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
siRNAs have been found associated with two different complexes: in the RISC complex mediating posttranscriptional gene silencing by targeting sequence-specific mRNA degradation (21) and in the RITS complex, which mediates the silencing of genes at the transcriptional level by affecting its chromatin structure (41). It is still unclear, however, how siRNAs are incorporated into these complexes. In some organisms, such as S. pombe, it seems that siRNAs are included in the RITS complex to effect and reinforce chromatin changes, requiring components of the RNAi pathway. In plants, siRNAs are used in both RISC and RITS complexes, which coexist to carry out posttranscriptional gene silencing and chromatin changes. The rules that determine which complex the siRNAs become incorporated into remain obscure. In this work we tested whether in Neurospora crassa the production of siRNAs might contemporarily activate both a PTGS mechanism and chromatin modifications. We used a previously characterized, stably silenced strain (6xw) that produces siRNAs from an al-1 transgenic tandem array (4). Using ChIP and antibodies against specific histone modifications, we looked for modifications at the endogenous al-1 locus. We found no significant changes in the chromatin state, indicating that siRNAs produced from the transgenic locus do not trigger modifications in trans of those histones tested. We cannot rule out that other untested histone modifications occur; however, if such modifications do take place, they do not affect the rate of transcription at the endogenous locus (8).

In Arabidopsis, chromatin modifications have been shown to be required for PTGS, since mutations in either the SWI2/SNF2 chromatin component (DDM1) or the major DNA methyltransferase (MET1) resulted in the release of PTGS (27). In Neurospora we found that the transgenic locus was hypermethylated in Lys9H3, a modification found associated with silent and heterochromatic loci (18, 20, 23, 29, 43). We found that despite this signature of silent chromatin, the transgenic locus continues to be transcribed in both sense and antisense orientations, albeit at a very low level. This is reminiscent of observations with S. pombe, in which centromeric regions that are transcribed in both sense and antisense orientations are also hypermethylated at Lys9H3 (43). Locus-specific Lys9H3 methylation requires the presence of components of the PTGS machinery in S. pombe and in plants. Our observation that Lys9H3 methylation of the transgene is not altered in the qde mutants indicates that in Neurospora components of the PTGS machinery are not involved in chromatin-based silencing. Our data are supported by those of Freitag et al., published during the preparation of the manuscript. They show that in Neurospora, mutants of RNAi have normal levels of DNA methylation and normal localization of a key heterochromatin protein, HP1 (17). In addition, they showed that mutants of RNAi were competent for de novo DNA methylation. It is interesting to note that Neurospora possesses homologs of components of the RITS complex, Chp1 and Tas3, suggesting the existence of a RITS complex. If such a complex does indeed exist in Neurospora, the fact that no chromatin changes are seen at the endogenous locus in the presence of transgenic siRNAs or when the PTGS machinery is mutated suggests that there is no communication between the RISC posttranscriptional gene-silencing pathway and the RITS chromatin-based silencing pathway. That is, siRNAs produced from transgene-induced PTGS are not incorporated in a RITS complex but rather are used solely in the RISC pathway to effect degradation of homologous mRNA.

We further evaluated the possible role of hypermethylation at Lys9H3 in activating and/or maintaining PTGS by knocking out the dim-5 gene that encodes the Neurospora histone Lys9H3 methyltransferase. This mutant displayed a marked increase in the rate of reversion of PTGS during vegetative growth. We found that reversion of silencing in the {Delta}dim-5 strain correlates, as previously observed in the wild-type background, with the loss of transgenic copies. Thus, the most likely explanation of our results is that methylation of Lys9H3 stabilizes the transgenic tandem array, thereby having an effect on the maintenance of PTGS. This hypothesis is also supported by the finding that in a wild-type background, spontaneous revertants of silencing that have lost some copies of the transgene are unable to maintain silencing despite the persistence of Lys9H3 methylation (Fig. 2A). Moreover, when dim-5 was mutated in a WT background (no al-1 transgene) and then tested for its ability to activate silencing, a dramatic decrease in silencing frequency was observed. Residually silenced transformants possessed transgenic copies in tandem, which were rapidly lost concurrently with reversion to a WT phenotype (Fig. 4C). We conclude that the methylation of Lys9H3 is not required for the activation of PTGS but that the defect in PTGS of the {Delta}dim-5 strains is due to the inability to maintain the transgene in tandem. Although the exact mechanism of the excision of transgenes in tandem is not understood, it is likely that it occurs through recombination between the homologous repeated sequences, suggesting that histone methylation may act to block recombination. This is consistent with findings in mammals in which mutants in Suv39h, a homolog of dim-5, showed gross errors in meiosis due to an increased number of nonhomologous interactions, resulting in reduced viability and chromosome instabilities (24, 36). Lys9H3 methylation, commonly found associated with repeated sequences (22), may impose low levels of genetic recombination, preserving the integrity and stability of the genome.

It has been shown that DIM-5 is essential for DNA methylation of RIP regions in Neurospora (40). We find that the deletion of DIM-5 also releases DNA methylation at the transgenic locus. It is interesting that another mutant, the dim-2 mutant, also defective in DNA methylation, did not display any defect either in the efficiency or in the stability of PTGS, as observed in the {Delta}dim-5 strain (8). This suggests that the effect of Lys9H3 methylation in reducing the level of recombination of the transgenic repeated sequences is not mediated by DNA methylation. Finally, it will be interesting to determine whether Lys9H3 methylation is generally involved in stabilization of repeated sequences.


    ACKNOWLEDGMENTS
 
We thank Prim Singh and Thomas Jenuwein for providing us with antibodies against trimethyl histone H3 Lys9. We also thank Valerio Orlando for valuable suggestions, Valerio Fulci and Gianluca Azzalin for their technical assistance and suggestions regarding the quantitative PCR data, Marco Baroni and the Dipartimento di Scienze Cliniche for use of their LightCycler instrument, and the Whitehead Institute for providing access to the Neurospora genome database.

This work was supported by grants from The European Community (no. QLK3-CT-2000-00078), the Instituto Pasteur Fondazione Cenci Bolognetti, FIRB-MIUR 2001 (RBNEO15MPB_001/RBNE01KXC9_006), and CNR 2003 (Progetto Strategico MIUR—legge 449/97).


    FOOTNOTES
 
* Corresponding author. Mailing address: Istituto Pasteur e Fondazione Cenci Bolognetti, Dipartimento di Biotecnologie Cellulari ed Ematologia, Sezione di Genetica Molecolare, Universita di Roma "La Sapienza," Viale Regina Elena, 324, 00161 Roma, Italy. Phone and fax: 0039 064457731. E-mail: macino{at}bce.uniroma1.it. Back

{dagger} Supplemental material for this article may be found at http://mcb.asm.org/. Back

{ddagger} Present address: Cold Spring Harbor Laboratory, 1 Bungtown Road, Cold Spring Harbor, NY 11724. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
1. Bernstein, B. E., E. L. Humphrey, R. L. Erlich, R. Schneider, P. Bouman, J. S. Liu, T. Kouzarides, and S. L. Schreiber. 2002. Methylation of histone H3 Lys 4 in coding regions of active genes. Proc. Natl. Acad. Sci. USA 99:8695-8700.[Abstract/Free Full Text]

2. Bernstein, E., A. A. Caudy, S. M. Hammond, and G. J. Hannon. 2001. Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 409:363-366.[CrossRef][Medline]

3. Catalanotto, C., G. Azzalin, G. Macino, and C. Cogoni. 2000. Gene silencing in worms and fungi. Nature 404:245.[CrossRef][Medline]

4. Catalanotto, C., G. Azzalin, G. Macino, and C. Cogoni. 2002. Involvement of small RNAs and role of the qde genes in the gene silencing pathway in Neurospora. Genes Dev. 16:790-795.[Abstract/Free Full Text]

5. Catalanotto, C., M. Pallotta, P. ReFalo, M. S. Sachs, L. Vayssie, G. Macino, and C. Cogoni. 2004. Redundancy of the two dicer genes in transgene-induced posttranscriptional gene silencing in Neurospora crassa. Mol. Cell. Biol. 24:2536-2545.[Abstract/Free Full Text]

6. Chicas, A., and G. Macino. 2001. Characteristics of post-transcriptional gene silencing. EMBO Rep. 2:992-996.[CrossRef][Medline]

7. Cogoni, C. 2001. Homology-dependent gene silencing mechanisms in fungi. Annu. Rev. Microbiol. 55:381-406.[CrossRef][Medline]

8. Cogoni, C., J. T. Irelan, M. Schumacher, T. J. Schmidhauser, E. U. Selker, and G. Macino. 1996. Transgene silencing of the al-1 gene in vegetative cells of Neurospora is mediated by a cytoplasmic effector and does not depend on DNA-DNA interactions or DNA methylation. EMBO J. 15:3153-3163.[Medline]

9. Cogoni, C., and G. Macino. 1999. Gene silencing in Neurospora crassa requires a protein homologous to RNA-dependent RNA polymerase. Nature 399:166-169.[CrossRef][Medline]

10. Cogoni, C., and G. Macino. 1997. Isolation of quelling-defective (qde) mutants impaired in posttranscriptional transgene-induced gene silencing in Neurospora crassa. Proc. Natl. Acad. Sci. USA 94:10233-10238.[Abstract/Free Full Text]

11. Cogoni, C., and G. Macino. 1999. Posttranscriptional gene silencing in Neurospora by a RecQ DNA helicase. Science 286:2342-2344.[Abstract/Free Full Text]

12. Cogoni, C., N. Romano, and G. Macino. 1994. Suppression of gene expression by homologous transgenes. Antonie Leeuwenhoek 65:205-209.

13. Cowell, I. G., R. Aucott, S. K. Mahadevaiah, P. S. Burgoyne, N. Huskisson, S. Bongiorni, G. Prantera, L. Fanti, S. Pimpinelli, R. Wu, D. M. Gilbert, W. Shi, R. Fundele, H. Morrison, P. Jeppesen, and P. B. Singh. 2002. Heterochromatin, HP1 and methylation at lysine 9 of histone H3 in animals. Chromosoma 111:22-36.[CrossRef][Medline]

14. Dalmay, T., A. Hamilton, S. Rudd, S. Angell, and D. C. Baulcombe. 2000. An RNA-dependent RNA polymerase gene in Arabidopsis is required for posttranscriptional gene silencing mediated by a transgene but not by a virus. Cell 101:543-553.[CrossRef][Medline]

15. Ebbole, D. J., and M. S. Sachs. 1990. A rapid and simple method for isolation of Neurospora crassa homokaryons using microconidia. Neurospora Newslett. 37:17-18.

16. Fire, A. 1999. RNA-triggered gene silencing. Trends Genet. 15:358-363.[CrossRef][Medline]

17. Freitag, M., D. W. Lee, G. O. Kothe, R. J. Pratt, R. Aramayo, and E. U. Selker. 2004. DNA methylation is independent of RNA interference in Neurospora. Science 304:1939.[Free Full Text]

18. Gendrel, A. V., Z. Lippman, C. Yordan, V. Colot, and R. A. Martienssen. 2002. Dependence of heterochromatic histone H3 methylation patterns on the Arabidopsis gene DDM1. Science 297:1871-1873.[Abstract/Free Full Text]

19. Goldoni, M., G. Azzalin, G. Macino, and C. Cogoni. 2004. Efficient gene silencing by expression of double stranded RNA in Neurospora crassa. Fungal Genet. Biol. 41:1016-1024.[CrossRef][Medline]

20. Hall, I. M., G. D. Shankaranarayana, K. Noma, N. Ayoub, A. Cohen, and S. I. Grewal. 2002. Establishment and maintenance of a heterochromatin domain. Science 297:2232-2237.[Abstract/Free Full Text]

21. Hammond, S. M., S. Boettcher, A. A. Caudy, R. Kobayashi, and G. J. Hannon. 2001. Argonaute2, a link between genetic and biochemical analyses of RNAi. Science 293:1146-1150.[Abstract/Free Full Text]

22. Henikoff, S. 2000. Heterochromatin function in complex genomes. Biochim. Biophys. Acta 1470:O1-O8.[Medline]

23. Kondo, Y., and J. P. Issa. 2003. Enrichment for histone H3 lysine 9 methylation at Alu repeats in human cells. J. Biol. Chem. 278:27658-27662.[Abstract/Free Full Text]

24. Lehnertz, B., Y. Ueda, A. A. Derijck, U. Braunschweig, L. Perez-Burgos, S. Kubicek, T. Chen, E. Li, T. Jenuwein, and A. H. Peters. 2003. Suv39h-mediated histone H3 lysine 9 methylation directs DNA methylation to major satellite repeats at pericentric heterochromatin. Curr. Biol. 13:1192-1200.[CrossRef][Medline]

25. Liu, Y., K. Mochizuki, and M. A. Gorovsky. 2004. Histone H3 lysine 9 methylation is required for DNA elimination in developing macronuclei in Tetrahymena. Proc. Natl. Acad. Sci. USA 101:1679-1684.[Abstract/Free Full Text]

26. Mette, M. F., W. Aufsatz, J. van der Winden, M. A. Matzke, and A. J. Matzke. 2000. Transcriptional silencing and promoter methylation triggered by double-stranded RNA. EMBO J. 19:5194-5201.[CrossRef][Medline]

27. Morel, J. B., P. Mourrain, C. Beclin, and H. Vaucheret. 2000. DNA methylation and chromatin structure affect transcriptional and post-transcriptional transgene silencing in Arabidopsis. Curr. Biol. 10:1591-1594.[CrossRef][Medline]

28. Mourrain, P., C. Beclin, T. Elmayan, F. Feuerbach, C. Godon, J. B. Morel, D. Jouette, A. M. Lacombe, S. Nikic, N. Picault, K. Remoue, M. Sanial, T. A. Vo, and H. Vaucheret. 2000. Arabidopsis SGS2 and SGS3 genes are required for posttranscriptional gene silencing and natural virus resistance. Cell 101:533-542.[CrossRef][Medline]

29. Nakayama, J., J. C. Rice, B. D. Strahl, C. D. Allis, and S. I. Grewal. 2001. Role of histone H3 lysine 9 methylation in epigenetic control of heterochromatin assembly. Science 292:110-113.[Abstract/Free Full Text]

30. Napoli, C., C. Lemieux, and R. Jorgensen. 1990. Introduction of a chimeric chalcone synthase gene into petunia results in reversible co-suppression of homologous genes in trans. Plant Cell 2:279-289.[Abstract/Free Full Text]

31. Noma, K., C. D. Allis, and S. I. Grewal. 2001. Transitions in distinct histone H3 methylation patterns at the heterochromatin domain boundaries. Science 293:1150-1155.[Abstract/Free Full Text]

32. Noma, K., and S. I. Grewal. 2002. Histone H3 lysine 4 methylation is mediated by Set1 and promotes maintenance of active chromatin states in fission yeast. Proc. Natl. Acad. Sci. USA 99(Suppl. 4):16438-16445.[Abstract/Free Full Text]

33. Orlando, V., H. Strutt, and R. Paro. 1997. Analysis of chromatin structure by in vivo formaldehyde cross-linking. Methods 11:205-214.[CrossRef][Medline]

34. Pal-Bhadra, M., B. A. Leibovitch, S. G. Gandhi, M. Rao, U. Bhadra, J. A. Birchler, and S. C. Elgin. 2004. Heterochromatic silencing and HP1 localization in Drosophila are dependent on the RNAi machinery. Science 303:669-672.[Abstract/Free Full Text]

35. Peters, A. H., S. Kubicek, K. Mechtler, R. J. O'Sullivan, A. A. Derijck, L. Perez-Burgos, A. Kohlmaier, S. Opravil, M. Tachibana, Y. Shinkai, J. H. Martens, and T. Jenuwein. 2003. Partitioning and plasticity of repressive histone methylation states in mammalian chromatin. Mol. Cell 12:1577-1589.[CrossRef][Medline]

36. Peters, A. H., D. O'Carroll, H. Scherthan, K. Mechtler, S. Sauer, C. Schofer, K. Weipoltshammer, M. Pagani, M. Lachner, A. Kohlmaier, S. Opravil, M. Doyle, M. Sibilia, and T. Jenuwein. 2001. Loss of the Suv39h histone methyltransferases impairs mammalian heterochromatin and genome stability. Cell 107:323-337.[CrossRef][Medline]

37. Romano, N., and G. Macino. 1992. Quelling: transient inactivation of gene expression in Neurospora crassa by transformation with homologous sequences. Mol. Microbiol. 6:3343-3353.[Medline]

38. Schramke, V., and R. Allshire. 2003. Hairpin RNAs and retrotransposon LTRs effect RNAi and chromatin-based gene silencing. Science 301:1069-1074.[Abstract/Free Full Text]

39. Staben, C., B. C. Jensen, M. J. Singer, J. Pollock, M. Schechtman, J. A. Kinsey, and E. Selker. 1989. Use of a bacterial hygromycin B resistance gene as a dominant selectable marker in Neurospora crassa transformation. Fungal Genet. Newsl. 36:79-81.

40. Tamaru, H., and E. U. Selker. 2001. A histone H3 methyltransferase controls DNA methylation in Neurospora crassa. Nature 414:277-283.[CrossRef][Medline]

41. Verdel, A., S. Jia, S. Gerber, T. Sugiyama, S. Gygi, S. I. Grewal, and D. Moazed. 2004. RNAi-mediated targeting of heterochromatin by the RITS complex. Science 303:672-676.[Abstract/Free Full Text]

42. Vollmer, L. J., and C. Yanofsky. 1986. Efficient cloning of genes of Neurospora crassa. Proc. Natl. Acad. Sci. USA 83:4869-4873.[Abstract/Free Full Text]

43. Volpe, T. A., C. Kidner, I. M. Hall, G. Teng, S. I. Grewal, and R. A. Martienssen. 2002. Regulation of heterochromatic silencing and histone H3 lysine-9 methylation by RNAi. Science 297:1833-1837.[Abstract/Free Full Text]

44. Wassenegger, M., S. Heimes, L. Riedel, and H. L. Sanger. 1994. RNA-directed de novo methylation of genomic sequences in plants. Cell 76:567-576.[CrossRef][Medline]

45. Zilberman, D., X. Cao, and S. E. Jacobsen. 2003. ARGONAUTE4 control of locus-specific siRNA accumulation and DNA and histone methylation. Science 299:716-719.[Abstract/Free Full Text]


Molecular and Cellular Biology, May 2005, p. 3793-3801, Vol. 25, No. 9
0270-7306/05/$08.00+0     doi:10.1128/MCB.25.9.3793-3801.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chicas, A.
Right arrow Articles by Macino, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chicas, A.
Right arrow Articles by Macino, G.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. J. Virol. Eukaryot. Cell
Microbiol. Mol. Biol. Rev. Clin. Vaccine Immunol. All ASM Journals