Previous Article | Next Article ![]()
Molecular and Cellular Biology, May 2005, p. 3793-3801, Vol. 25, No. 9
0270-7306/05/$08.00+0 doi:10.1128/MCB.25.9.3793-3801.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Emma C. Forrest,
Silvia Sepich,
Carlo Cogoni, and
Giuseppe Macino*
Istituto Pasteur e Fondazione Cenci Bolognetti, Dipartimento di Biotecnologie Cellulari ed Ematologia, Sezione di Genetica Molecolare, Universita di Roma "La Sapienza," Viale Regina Elena, 324, 00161 Roma, Italy
Received 5 August 2004/ Returned for modification 20 September 2004/ Accepted 1 February 2005
| ABSTRACT |
|---|
|
|
|---|
dim-5 strain is due to the inability to maintain the transgene in tandem, suggesting a role for DIM-5 in stabilizing such repeated sequences. We conclude that in Neurospora, siRNAs produced from the transgenic locus are used in the RNA-induced silencing complex-mediated PTGS pathway and do not communicate with an RNAi-induced initiation of transcriptional gene silencing complex to effect chromatin-based silencing. | INTRODUCTION |
|---|
|
|
|---|
Efforts to elucidate the mechanism of posttranscriptional gene silencing have revealed that it is commonly conserved among organisms. Fungi, like plants and animals, require the RNase III-type enzyme Dicer (5) and proteins of the PPD family (3). Plants and fungi also require the presence of an RNA-dependent RNA polymerase (9, 14, 28) in transgene-induced silencing, presumably creating double-stranded RNA (dsRNA) from the single-stranded-RNA template to be used as a target for Dicer. Dicer has been shown to cleave long dsRNAs into 21-23 small interfering RNAs (siRNAs) (2), which, in conjunction with the proteins of the PPD family, make up the RNA-induced silencing complex (RISC) that degrades the native mRNA (21).
siRNAs have been found to be involved not only in PTGS by targeting sequence-specific RNA degradation but also in silencing genes at the transcriptional level by inducing locus-specific epigenetic changes. The first evidence of an RNA-directed epigenetic change was provided in tobacco plants in which viroids that have dsRNA replication intermediates were able to induce methylation of homologous nuclear DNA sequences (44). Subsequently, it was found that dsRNA directed against a promoter sequence could induce DNA methylation and block transcription of the associated gene (26). A clear example that siRNAs can work in trans came from work with Schizosaccharomyces pombe, where siRNAs derived from the processing of a dsRNA expressed from a transgenic inverted repeat were able to induce chromatin modifications and transcriptional silencing of a unlinked homologous sequence (38). Components of the RNAi machinery, such as RNA-dependent RNA polymerase, Ago1, and Dicer, were shown to be necessary for the formation of proper heterochromatin structure, confirming the link between the siRNA-mediated silencing pathway and heterochromatin. Moreover, the identification of an RNA-induced initiation of transcriptional gene silencing (RITS) complex that binds, in a siRNA-directed fashion, to centromeric heterochromatin further elucidates the molecular basis of transcriptional silencing mediated by siRNAs (41). Studies have shown that plants possess a similar system to mediate chromatin changes. Zilberman et al. found that a PPD family protein, Ago4, and siRNAs were required to direct methylation of Lys9H3 at a transposon locus (45). The requirement of components of the RNAi machinery in directing locus-specific Lys9H3 methylation has also been demonstrated with Drosophila (34) and Tetrahymena (25). Together these studies point to the existence of a conserved mechanism in eukaryotes that uses siRNAs in conjunction with a RITS complex to direct epigenetic modifications.
Although it is clear that the RNAi machinery can be devoted to direct epigenetic modifications and eventually transcriptional gene silencing, another line of evidence suggests that chromatin modifications may themselves be important in activating and/or maintaining PTGS. In fact, in Arabidopsis, mutations in either a SWI2/SNF2 chromatin component (DDM1) or the major DNA methyltransferase (MET1) resulted in the release of PTGS (27). Thus, a self-reinforcing model may be proposed in which chromatin modifications activate the production of siRNAs that in turn contribute to maintaining and reinforcing such modifications.
With Neurospora crassa, we have previously demonstrated that a tandem transgenic repeat is the source of siRNAs that have been shown to induce the degradation of a homologous endogenous mRNA (4). Here, we have tested the hypothesis that the production of transgenic siRNAs may simultaneously activate both a PTGS mechanism and induce modifications of histones at both the transgene al-1 and endogenous al-1 loci. We carried out chromatin immunoprecipitation (ChIP) using different antibodies against specific histone modifications but detected no alterations in the pattern of histone modifications at the endogenous al-1 locus, suggesting that siRNAs produced from the transgenic locus do not trigger modifications in trans of those histones tested. We analyzed the chromatin status of the transgene and found that the transgenic locus was hypermethylated at Lys9 of histone H3 (Lys9H3). To evaluate the possible role of this hypermethylation in the activation and maintenance of PTGS, we knocked out the dim-5 gene, which encodes the Neurospora Lys9H3 methyltransferase. While the dim-5 mutants were able to establish PTGS, albeit at a much-reduced efficiency, they were unable to maintain it, with transgenic copies being rapidly lost, resulting in reversion of the silenced phenotype. These results indicate that the defect in PTGS of the
dim-5 strain is due to the inability to maintain the tandemly organized transgene.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Quantification of immunoprecipitated DNA. Quantification was performed using a real-time PCR machine, LightCycler (Roche), with FastStart DNA Master SYBR green 1 kit (Roche). Data were analyzed with built-in LightCycler software, version 3.01, using the second derivative method for determining the crossing point (Cp) value for each sample.
The primers used for quantitative PCR were as follows. P1, 5' CACTAAAGGGAACAAAAGCTGGA 3'; P2, 5' TCTTTTCGAGAACTGTGACGTCTAC 3'; P3, 5' TGAAGTCGTTCTTTTCGAGAACTG 3'; P4, 5' GCGCGCAATTAACCCTCAC 3'; P5, 5' ACC GAT TCA CGA CCC TCT CTT 3'; P6, 5' CGG AGA CGG CAT CAT CAC A 3'; Wc1 upper, 5' TCAACATCTTCCGCCTCATCTC 3'; Wc1 lower, 5' ATGCTGCTGATGCTGCTTATGC 3'.
Transgenic DNA was amplified using the primer P2 derived from the bacterial vector sequence and the primer P1 from the al-1 transgene to avoid amplification of the endogenous al-1 gene DNA. The primers for the endogenous al-1 gene (P5 and P6) were derived from a 5' region not included in the transgene to avoid amplification of transgenic al-1 DNA (see Fig. 1D). The white collar (wc-1) primers are derived from the 3' region of the wc-1 gene. Primers were designed to give products between 80 and 110 bp and were empirically tested to make sure they did not produce primer-primer dimers.
|
Western blot analysis of protein. Tissue was ground in liquid nitrogen with a mortar and pestle and suspended in ice-cold lysis buffer (50 mM HEPES [pH 7.4], 137 mM KCl, 10% glycerol containing 1 mM phenylmethylsulfonyl fluoride, 1 mM EDTA, 1 mM leupeptin, 1 mM pepstatin A) at a ratio of 0.5 ml of buffer to 0.1 g of tissue. Extracts were homogenized by three strokes of a Teflon/glass homogenizer, and cellular debris was removed by centrifugation at 10,000 x g. The protein concentration of the supernatant was determined with the Bio-Rad reagent according to the manufacturer's instructions. Equal quantities of proteins (100 µg) for different extracts were denatured in Laemmli sample buffer and separated by 15% SDS-PAGE. After transfer to nitrocellulose (Amersham), blots were incubated with either anti-trimethyl Lys9H3 or anti-trimethyl Lys4H3 antibodies. Horseradish peroxidase-conjugated anti-rabbit immunoglobulin G was used as a secondary antibody (Bio-Rad), and Western blots were developed using chemiluminescence (ECL; Amersham).
RT and quantitative PCR. Reverse transcription (RT) was done with SuperScript II H- Reverse transcriptase (Invitrogen) according to the manufacturer's conditions except as follows: the amount of total RNA was 5 µg, and the amount of gene-specific primer was 2 pmol. Reverse transcription was carried out with either the RTSS (AGT GAG CGC GCG TAA TAC GA) or RTAS (CAA GGA GTC CTT TGA CGC TA) primers, which are immediately upstream of P1 and P2, respectively. One-tenth of the RT reaction volume was used for the PCRs, which were performed using the P1-P2 primer pair. The PCR products were run on a 2% agarose gel and visualized by ethidium bromide staining. We also quantified the PCR products by real-time PCR using Roche's FastStart DNA Master SYBR green 1 kit. The quantification was done using an external standard curve made with a serial dilution of one of the RT reactions. The efficiency of reverse transcription among different samples was normalized by including an actin-specific primer in all RT reactions and quantifying the amount of actin RNA.
Neurospora crassa strains, media, and growth conditions. Strains were grown in Vogel's minimal medium for Neurospora in the presence of appropriate nutritional supplements and/or selectable markers. Preparation of N. crassa spheroplasts and transformation with recombinant plasmids were performed as reported by Vollmer and Yanofsky (42). The stably silenced strain (6xw) was previously described (8), as were the qde mutant strains (10). Strains 74-OR23A (FGSC no. 987) and 74-OR8a (FGSC no. 988) were obtained from the Fungal Genetics Stock Center, University of Kansas, Kansas City, Kansas.
Purification by microconidia. Since Neurospora is a multinucleate syncytial organism, in order to ensure that all strains were homokaryotic, we purified it by isolation of microconidia as described in reference 15.
Isolation of the
dim-5 strain.
To obtain a
dim-5 strain, we performed site-specific insertional mutagenesis by transforming spheroplasts of the 6xw strain with a linear DNA fragment containing two sequences homologous to the upstream and downstream regions of the dim-5 genomic locus on either side of a hygromycin resistance cassette. The deleted strains have the gene for hygromycin resistance in place of the dim-5 coding region. Proper integration of the construct was confirmed by Southern blot analyses of hygromycin-resistant colonies (data not shown). In brief, genomic DNA preparations from hygromycin-resistant colonies were digested with SpeI and hybridized with a DNA 32P-labeled probe corresponding to the genomic region upstream of the 5' region used to direct recombination at the dim-5 locus. The absence of unique SpeI sites in the endogenous, nondisrupted dim-5 gene and the presence of SpeI in the hygromycin cassette of the replacement construct allowed the recombinant strains to be distinguished from the wild type (WT). The recombinant strain displaying the correct hybridization pattern was then purified by microconidia (15). In order to produce a
dim-5 mutant, allowing us to test for the ability to initiate silencing, we crossed the 6xw
dim-5 strain to remove the transgenic al-1 copies (either by chromosomal rearrangements or through repeat-induced point mutation [RIP], which efficiently mutates G:C to A:T). We crossed the 6xw
dim-5 strain with wild-type (WT) 74-OR23A (FGSC no. 987), and resulting ascospores were selected for nonsilenced, dim-5
; qa-2; aro-9, by their ability to grow on plates containing hygromycin and supplemented with a mixture of aromatic amino acids. The activity of either the enzyme ARO-9 or QA-2 is required for the biosynthesis of aromatic amino acids. The
dim-5 qa-2; aro-9 strain, once transformed with the plasmid pX16, which contains the al-1 transgene, can grow without the aromatic acids, since the vector also contains the gene encoding qa-2. Expression of QA-2 is sufficient to allow growth in minimal media.
Plasmid constructions. PCR amplification of wild-type N. crassa DNA was carried out using Taq DNA polymerase (Promega) with pairs of forward and reverse primers for upstream and downstream regions of the dim-5 locus. Forward and reverse primers for the upstream dim-5 region contained KpnI and XhoI restriction sites, respectively, whereas forward and reverse primers for its downstream region contained SpeI and NotI sites. The following primers were used: Dim5 forward upstream arm, 5'-GGC GGG GTA CCT GAA AAT GGT GCA CCA GG-3'; Dim5 reverse upstream arm, 5'-CCG CTC GAG ACG CTT TCT CCA TCT TGG-3'; Dim5 forward downstream arm, 5'-GGA CTA GTG GGG GAA GAT GTT AAC TC-3'; and Dim5 reverse downstream arm, 5'-AAG GAA AAA AGC GGC CGC GAT GTT TCC CCT GAA TGG-3'.
The PCR products were gel purified and digested with the appropriate enzymes, and both upstream and downstream fragments for a single locus were ligated into plasmid pCSN44 (39) to place a fragment on each side of the hygromycin resistance expression cassette. This plasmid was linearized by digestion with KpnI/NotI and purified by phenol-chloroform extraction and ethanol precipitation.
Southern blot. To identify knockout strains, five micrograms of chromosomal DNA digested with SpeI was fractionated by electrophoresis on a 0.8% agarose gel. The DNA was transferred onto GeneScreenPlus (NEN) filters by capillary blotting. Filters were prehybridized and hybridized at 65°C according to GeneScreenPlus procedures. The 32P-labeled probes used were prepared using a random-primed DNA labeling kit (Roche) as described by the manufacturer. The probe for the knock out was 500 bp long and synthesized by PCR amplification with 21-mer oligonucleotides from chromosomal DNA. The used primers were as follows: Dim5 forward probe, 5'-CGA CTA TCT ACC TAC CTA TCC-3'; Dim5 reverse probe, 5'-TAT GTT GGG AGA GGT TTC GGG-3'. For detection of the al-1 transgene instead, a labeled 1.3-kb XbaI/ClaI fragment of the al-1 gene, able to detect both endogenous and transgenic al-1 sequences, was used. Probes were 32P labeled using a random-primed DNA labeling kit (Roche) as described by the manufacturer.
| RESULTS |
|---|
|
|
|---|
Analysis of histone modifications at the transgenic locus. Factors that affect chromatin structure have been shown to be important to activate and/or maintain PTGS in plants (27); we therefore examined the chromatin structure of the transgenic locus in the 6xw strain. We previously calculated that this strain has 25 copies of the plasmid containing the transgene organized in a head-to-tail manner (8). Transgenic DNA was amplified using a primer derived from the bacterial vector sequence (P2) and the other from the al-1 transgene (P1) to avoid amplification of the endogenous al-1 gene DNA (see Fig. 1D). The amount of transgenic al-1 DNA immunoprecipitated with a battery of antibodies was compared to the amount of the single endogenous wc-1 DNA immunoprecipitated in the same IP. We found a sixfold enrichment in transgenic DNA immunoprecipitated with an antibody that recognizes trimethylated Lys9H3 (Fig. 1B). Since we cannot distinguish one transgenic copy from another across the tandemly repeated region, this enrichment is the average level of Lys9H3 methylation across the region. It is important to point out that the fold enrichment values are internally corrected for copy number (see Materials and Methods for details). In addition, a fivefold reduction in transgenic DNA immunoprecipitated with the anti-acetyl H3-Lys9/Lys14 was detected. Hypermethylation of Lys9H3 and hypomethylation of Lys4H3 have been found associated with heterochromatin (31), while hypermethylation of Lys4H3 has been found associated mainly with active chromatin (1, 32). As shown in Fig. 1B, we found no alteration of Lys4H3 methylation with respect to the endogenous wc-1 control. Previous results indicated that the transgenic locus was transcribed in sense polarity, suggesting that the hypermethylation of Lys9H3 does not completely block transcription (8). Here we show by using RT-PCR that the transgenic locus is transcribed in both sense and antisense orientations (Fig. 1C), albeit at a low level.
The role of the PTGS machinery in Lys9H3 methylation. Following the finding that the transgenic locus was hypermethylated in Lys9H3, we asked whether the PTGS machinery was required for the formation or maintenance of this heterochromatic state at the transgenic locus. If the siRNAs are functioning in cis in a feedback loop to facilitate binding of chromatin complexes, we may expect a change in the level of hypermethylation of Lys9H3 in the absence of the PTGS machinery. We therefore prepared chromatin from the different qde mutants and carried out immunoprecipitations with the antibody that recognizes trimethylated Lys9H3. No significant changes in Lys9H3 methylation of the transgenic (Fig. 2A) or endogenous (Fig. 2B) locus were observed in the qde mutants or in a revertant strain. The latter is a strain that has lost the silenced phenotype due to the loss of 80% of transgenic copies (10). These results indicate that the hypermethylation of Lys9H3 at the transgenic locus does not require the function of the qde genes.
|
dim-5 strains were further characterized by Western blot analysis of a crude protein extract using an anti-trimethyl Lys9H3 antibody. We observed a significant reduction in Lys9H3 methylation in the
dim-5 strain (Fig. 3A), indicating that as previously demonstrated, dim-5 is the major if not the only enzyme required for Lys9H3 methylation (40). DIM-5 has been shown to be indirectly required for DNA methylation of duplicate sequences mutated by RIP in Neurospora (40). We have previously shown that the al-1 transgene is heavily DNA methylated (8). We therefore examined whether DNA methylation of the transgene was affected in the
dim-5 strain. Southern blot analysis of genomic DNA digested with either Sau3AI, which is inhibited by cytosine methylation, or the cytosine methylation-insensitive isoschizomer DpnII shows that DNA methylation of the transgene is lost in the
dim-5 strain (Fig. 3B). This result indicates that DIM-5 is also required for DNA methylation of non-RIP repeated sequences.
|
dim-5 strains to a silenced strain with an intact dim-5 gene. We plated conidia (vegetative spores) from the
dim-5 silenced strains and the control dim-5+ quelled strain, picked individual colonies, and scored by visual inspection for the albino phenotype. Loss of the albino phenotype (so-called "revertant") was observed in less than 1% of the colonies in our control. In the
dim-5 strain, loss of the albino phenotype was seen in more than 70% of colonies analyzed. The remaining silenced colonies lost the albino phenotype in subsequent generations (Fig. 4B). This result indicates that Lys9H3 methylation may play a role in the maintenance of PTGS. We then examined if the loss of the albino phenotype in the
dim-5 strain was due to the loss of transgene copies by analyzing the transgenic copy number in the revertant strains by Southern blot analysis. Genomic DNA was digested with SmaI and HindIII, which cut in the endogenous al-1 locus to give a 3.1-kb band. The transgenic locus gives a band of 5.5 kb as it is cut only by SmaI and not by HindIII. Figure 4A shows that all revertants (lanes 1 to 10) have lost copies of the transgene compared to colonies that were still silenced (lanes 12 to 13) or the parental strain, 6xw (lane 11). We also analyzed those
dim-5 colonies that were still white but reverted to a nonsilenced phenotype in subsequent passages and found that they progressively lost transgenic copies when colonies were propagated by vegetative growth (Fig. 4B). These data suggest that DIM-5 affects the maintenance of PTGS in Neurospora by stabilizing transgenes integrated in tandem.
|
dim-5 strain derived from the 6xw strain to a wild-type strain (WT
dim-5) (see Materials and Methods). Spheroplasts from this strain were then transformed with the plasmid pX16, which contains a fragment of the al-1 gene (8), and the plasmid pIR, which contains an inverted repeat of the al-1 gene that directly expresses dsRNA. We have recently shown that this construct (pIR) induces silencing of the al-1 gene (showing an albino phenotype) with 80% efficiency in a wild-type strain and that pIR bypasses the function of the qde-1 and qde-3 genes, confirming their requirement upstream of the production of the dsRNA (19). These transformants were also shown to be highly stable, with less than 1% reverting to a wild-type phenotype. Transformation of pIR into the WT
dim-5 strain resulted in 77% silencing (out of 100 transformants analyzed), indicating that dim-5 is not required for steps downstream of the synthesis of the dsRNA, i.e., the production of siRNAs. This is contrary to results seen in S. pombe, where the Lys9H3 methyltransferase clr-4 is required for the efficient production of siRNAs from dsRNA (38). Instead, when we transformed the transgenic albino-1 pX16 into the WT
dim-5 strain, only 6% (from 300 analyzed) of transformants showed an albino phenotype compared to the 20 to 40% usually found in the wild-type strain. The presence of silenced transformants indicates that dim-5 is not required for the activation of PTGS. Because DIM-5 appeared to be required to stabilize the transgenic locus, we analyzed the
dim-5 al-1 transformants by Southern blotting in order to determine the transgenic copy number. We observed that all nonsilenced strains analyzed had a very few copies of the transgene (data not shown) and that the residual silenced transformants had copies inserted in tandem (Fig. 4C). However, these transformants rapidly reverted to a WT phenotype. As we had previously observed with the 6xw strain deleted in dim-5, this reversion was associated with loss of transgenic copies in tandem (Fig. 4D). On the contrary, WT transformants containing the al-1 transgene maintained copies in tandem (Fig. 4D). These data support the idea that the reduction in PTGS efficiency is due to a rapid loss of transgenic DNA following integration. | DISCUSSION |
|---|
|
|
|---|
In Arabidopsis, chromatin modifications have been shown to be required for PTGS, since mutations in either the SWI2/SNF2 chromatin component (DDM1) or the major DNA methyltransferase (MET1) resulted in the release of PTGS (27). In Neurospora we found that the transgenic locus was hypermethylated in Lys9H3, a modification found associated with silent and heterochromatic loci (18, 20, 23, 29, 43). We found that despite this signature of silent chromatin, the transgenic locus continues to be transcribed in both sense and antisense orientations, albeit at a very low level. This is reminiscent of observations with S. pombe, in which centromeric regions that are transcribed in both sense and antisense orientations are also hypermethylated at Lys9H3 (43). Locus-specific Lys9H3 methylation requires the presence of components of the PTGS machinery in S. pombe and in plants. Our observation that Lys9H3 methylation of the transgene is not altered in the qde mutants indicates that in Neurospora components of the PTGS machinery are not involved in chromatin-based silencing. Our data are supported by those of Freitag et al., published during the preparation of the manuscript. They show that in Neurospora, mutants of RNAi have normal levels of DNA methylation and normal localization of a key heterochromatin protein, HP1 (17). In addition, they showed that mutants of RNAi were competent for de novo DNA methylation. It is interesting to note that Neurospora possesses homologs of components of the RITS complex, Chp1 and Tas3, suggesting the existence of a RITS complex. If such a complex does indeed exist in Neurospora, the fact that no chromatin changes are seen at the endogenous locus in the presence of transgenic siRNAs or when the PTGS machinery is mutated suggests that there is no communication between the RISC posttranscriptional gene-silencing pathway and the RITS chromatin-based silencing pathway. That is, siRNAs produced from transgene-induced PTGS are not incorporated in a RITS complex but rather are used solely in the RISC pathway to effect degradation of homologous mRNA.
We further evaluated the possible role of hypermethylation at Lys9H3 in activating and/or maintaining PTGS by knocking out the dim-5 gene that encodes the Neurospora histone Lys9H3 methyltransferase. This mutant displayed a marked increase in the rate of reversion of PTGS during vegetative growth. We found that reversion of silencing in the
dim-5 strain correlates, as previously observed in the wild-type background, with the loss of transgenic copies. Thus, the most likely explanation of our results is that methylation of Lys9H3 stabilizes the transgenic tandem array, thereby having an effect on the maintenance of PTGS. This hypothesis is also supported by the finding that in a wild-type background, spontaneous revertants of silencing that have lost some copies of the transgene are unable to maintain silencing despite the persistence of Lys9H3 methylation (Fig. 2A). Moreover, when dim-5 was mutated in a WT background (no al-1 transgene) and then tested for its ability to activate silencing, a dramatic decrease in silencing frequency was observed. Residually silenced transformants possessed transgenic copies in tandem, which were rapidly lost concurrently with reversion to a WT phenotype (Fig. 4C). We conclude that the methylation of Lys9H3 is not required for the activation of PTGS but that the defect in PTGS of the
dim-5 strains is due to the inability to maintain the transgene in tandem. Although the exact mechanism of the excision of transgenes in tandem is not understood, it is likely that it occurs through recombination between the homologous repeated sequences, suggesting that histone methylation may act to block recombination. This is consistent with findings in mammals in which mutants in Suv39h, a homolog of dim-5, showed gross errors in meiosis due to an increased number of nonhomologous interactions, resulting in reduced viability and chromosome instabilities (24, 36). Lys9H3 methylation, commonly found associated with repeated sequences (22), may impose low levels of genetic recombination, preserving the integrity and stability of the genome.
It has been shown that DIM-5 is essential for DNA methylation of RIP regions in Neurospora (40). We find that the deletion of DIM-5 also releases DNA methylation at the transgenic locus. It is interesting that another mutant, the dim-2 mutant, also defective in DNA methylation, did not display any defect either in the efficiency or in the stability of PTGS, as observed in the
dim-5 strain (8). This suggests that the effect of Lys9H3 methylation in reducing the level of recombination of the transgenic repeated sequences is not mediated by DNA methylation. Finally, it will be interesting to determine whether Lys9H3 methylation is generally involved in stabilization of repeated sequences.
| ACKNOWLEDGMENTS |
|---|
This work was supported by grants from The European Community (no. QLK3-CT-2000-00078), the Instituto Pasteur Fondazione Cenci Bolognetti, FIRB-MIUR 2001 (RBNEO15MPB_001/RBNE01KXC9_006), and CNR 2003 (Progetto Strategico MIURlegge 449/97).
| FOOTNOTES |
|---|
Supplemental material for this article may be found at http://mcb.asm.org/. ![]()
Present address: Cold Spring Harbor Laboratory, 1 Bungtown Road, Cold Spring Harbor, NY 11724. ![]()
| REFERENCES |
|---|
|
|
|---|
2. Bernstein, E., A. A. Caudy, S. M. Hammond, and G. J. Hannon. 2001. Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 409:363-366.[CrossRef][Medline]
3. Catalanotto, C., G. Azzalin, G. Macino, and C. Cogoni. 2000. Gene silencing in worms and fungi. Nature 404:245.[CrossRef][Medline]
4. Catalanotto, C., G. Azzalin, G. Macino, and C. Cogoni. 2002. Involvement of small RNAs and role of the qde genes in the gene silencing pathway in Neurospora. Genes Dev. 16:790-795.
5. Catalanotto, C., M. Pallotta, P. ReFalo, M. S. Sachs, L. Vayssie, G. Macino, and C. Cogoni. 2004. Redundancy of the two dicer genes in transgene-induced posttranscriptional gene silencing in Neurospora crassa. Mol. Cell. Biol. 24:2536-2545.
6. Chicas, A., and G. Macino. 2001. Characteristics of post-transcriptional gene silencing. EMBO Rep. 2:992-996.[CrossRef][Medline]
7. Cogoni, C. 2001. Homology-dependent gene silencing mechanisms in fungi. Annu. Rev. Microbiol. 55:381-406.[CrossRef][Medline]
8. Cogoni, C., J. T. Irelan, M. Schumacher, T. J. Schmidhauser, E. U. Selker, and G. Macino. 1996. Transgene silencing of the al-1 gene in vegetative cells of Neurospora is mediated by a cytoplasmic effector and does not depend on DNA-DNA interactions or DNA methylation. EMBO J. 15:3153-3163.[Medline]
9. Cogoni, C., and G. Macino. 1999. Gene silencing in Neurospora crassa requires a protein homologous to RNA-dependent RNA polymerase. Nature 399:166-169.[CrossRef][Medline]
10. Cogoni, C., and G. Macino. 1997. Isolation of quelling-defective (qde) mutants impaired in posttranscriptional transgene-induced gene silencing in Neurospora crassa. Proc. Natl. Acad. Sci. USA 94:10233-10238.
11. Cogoni, C., and G. Macino. 1999. Posttranscriptional gene silencing in Neurospora by a RecQ DNA helicase. Science 286:2342-2344.
12. Cogoni, C., N. Romano, and G. Macino. 1994. Suppression of gene expression by homologous transgenes. Antonie Leeuwenhoek 65:205-209.
13. Cowell, I. G., R. Aucott, S. K. Mahadevaiah, P. S. Burgoyne, N. Huskisson, S. Bongiorni, G. Prantera, L. Fanti, S. Pimpinelli, R. Wu, D. M. Gilbert, W. Shi, R. Fundele, H. Morrison, P. Jeppesen, and P. B. Singh. 2002. Heterochromatin, HP1 and methylation at lysine 9 of histone H3 in animals. Chromosoma 111:22-36.[CrossRef][Medline]
14. Dalmay, T., A. Hamilton, S. Rudd, S. Angell, and D. C. Baulcombe. 2000. An RNA-dependent RNA polymerase gene in Arabidopsis is required for posttranscriptional gene silencing mediated by a transgene but not by a virus. Cell 101:543-553.[CrossRef][Medline]
15. Ebbole, D. J., and M. S. Sachs. 1990. A rapid and simple method for isolation of Neurospora crassa homokaryons using microconidia. Neurospora Newslett. 37:17-18.
16. Fire, A. 1999. RNA-triggered gene silencing. Trends Genet. 15:358-363.[CrossRef][Medline]
17. Freitag, M., D. W. Lee, G. O. Kothe, R. J. Pratt, R. Aramayo, and E. U. Selker. 2004. DNA methylation is independent of RNA interference in Neurospora. Science 304:1939.
18. Gendrel, A. V., Z. Lippman, C. Yordan, V. Colot, and R. A. Martienssen. 2002. Dependence of heterochromatic histone H3 methylation patterns on the Arabidopsis gene DDM1. Science 297:1871-1873.
19. Goldoni, M., G. Azzalin, G. Macino, and C. Cogoni. 2004. Efficient gene silencing by expression of double stranded RNA in Neurospora crassa. Fungal Genet. Biol. 41:1016-1024.[CrossRef][Medline]
20. Hall, I. M., G. D. Shankaranarayana, K. Noma, N. Ayoub, A. Cohen, and S. I. Grewal. 2002. Establishment and maintenance of a heterochromatin domain. Science 297:2232-2237.
21. Hammond, S. M., S. Boettcher, A. A. Caudy, R. Kobayashi, and G. J. Hannon. 2001. Argonaute2, a link between genetic and biochemical analyses of RNAi. Science 293:1146-1150.
22. Henikoff, S. 2000. Heterochromatin function in complex genomes. Biochim. Biophys. Acta 1470:O1-O8.[Medline]
23. Kondo, Y., and J. P. Issa. 2003. Enrichment for histone H3 lysine 9 methylation at Alu repeats in human cells. J. Biol. Chem. 278:27658-27662.
24. Lehnertz, B., Y. Ueda, A. A. Derijck, U. Braunschweig, L. Perez-Burgos, S. Kubicek, T. Chen, E. Li, T. Jenuwein, and A. H. Peters. 2003. Suv39h-mediated histone H3 lysine 9 methylation directs DNA methylation to major satellite repeats at pericentric heterochromatin. Curr. Biol. 13:1192-1200.[CrossRef][Medline]
25. Liu, Y., K. Mochizuki, and M. A. Gorovsky. 2004. Histone H3 lysine 9 methylation is required for DNA elimination in developing macronuclei in Tetrahymena. Proc. Natl. Acad. Sci. USA 101:1679-1684.
26. Mette, M. F., W. Aufsatz, J. van der Winden, M. A. Matzke, and A. J. Matzke. 2000. Transcriptional silencing and promoter methylation triggered by double-stranded RNA. EMBO J. 19:5194-5201.[CrossRef][Medline]
27. Morel, J. B., P. Mourrain, C. Beclin, and H. Vaucheret. 2000. DNA methylation and chromatin structure affect transcriptional and post-transcriptional transgene silencing in Arabidopsis. Curr. Biol. 10:1591-1594.[CrossRef][Medline]
28. Mourrain, P., C. Beclin, T. Elmayan, F. Feuerbach, C. Godon, J. B. Morel, D. Jouette, A. M. Lacombe, S. Nikic, N. Picault, K. Remoue, M. Sanial, T. A. Vo, and H. Vaucheret. 2000. Arabidopsis SGS2 and SGS3 genes are required for posttranscriptional gene silencing and natural virus resistance. Cell 101:533-542.[CrossRef][Medline]
29. Nakayama, J., J. C. Rice, B. D. Strahl, C. D. Allis, and S. I. Grewal. 2001. Role of histone H3 lysine 9 methylation in epigenetic control of heterochromatin assembly. Science 292:110-113.
30. Napoli, C., C. Lemieux, and R. Jorgensen. 1990. Introduction of a chimeric chalcone synthase gene into petunia results in reversible co-suppression of homologous genes in trans. Plant Cell 2:279-289.
31. Noma, K., C. D. Allis, and S. I. Grewal. 2001. Transitions in distinct histone H3 methylation patterns at the heterochromatin domain boundaries. Science 293:1150-1155.
32. Noma, K., and S. I. Grewal. 2002. Histone H3 lysine 4 methylation is mediated by Set1 and promotes maintenance of active chromatin states in fission yeast. Proc. Natl. Acad. Sci. USA 99(Suppl. 4):16438-16445.
33. Orlando, V., H. Strutt, and R. Paro. 1997. Analysis of chromatin structure by in vivo formaldehyde cross-linking. Methods 11:205-214.[CrossRef][Medline]
34. Pal-Bhadra, M., B. A. Leibovitch, S. G. Gandhi, M. Rao, U. Bhadra, J. A. Birchler, and S. C. Elgin. 2004. Heterochromatic silencing and HP1 localization in Drosophila are dependent on the RNAi machinery. Science 303:669-672.
35. Peters, A. H., S. Kubicek, K. Mechtler, R. J. O'Sullivan, A. A. Derijck, L. Perez-Burgos, A. Kohlmaier, S. Opravil, M. Tachibana, Y. Shinkai, J. H. Martens, and T. Jenuwein. 2003. Partitioning and plasticity of repressive histone methylation states in mammalian chromatin. Mol. Cell 12:1577-1589.[CrossRef][Medline]
36. Peters, A. H., D. O'Carroll, H. Scherthan, K. Mechtler, S. Sauer, C. Schofer, K. Weipoltshammer, M. Pagani, M. Lachner, A. Kohlmaier, S. Opravil, M. Doyle, M. Sibilia, and T. Jenuwein. 2001. Loss of the Suv39h histone methyltransferases impairs mammalian heterochromatin and genome stability. Cell 107:323-337.[CrossRef][Medline]
37. Romano, N., and G. Macino. 1992. Quelling: transient inactivation of gene expression in Neurospora crassa by transformation with homologous sequences. Mol. Microbiol. 6:3343-3353.[Medline]
38. Schramke, V., and R. Allshire. 2003. Hairpin RNAs and retrotransposon LTRs effect RNAi and chromatin-based gene silencing. Science 301:1069-1074.
39. Staben, C., B. C. Jensen, M. J. Singer, J. Pollock, M. Schechtman, J. A. Kinsey, and E. Selker. 1989. Use of a bacterial hygromycin B resistance gene as a dominant selectable marker in Neurospora crassa transformation. Fungal Genet. Newsl. 36:79-81.
40. Tamaru, H., and E. U. Selker. 2001. A histone H3 methyltransferase controls DNA methylation in Neurospora crassa. Nature 414:277-283.[CrossRef][Medline]
41. Verdel, A., S. Jia, S. Gerber, T. Sugiyama, S. Gygi, S. I. Grewal, and D. Moazed. 2004. RNAi-mediated targeting of heterochromatin by the RITS complex. Science 303:672-676.
42. Vollmer, L. J., and C. Yanofsky. 1986. Efficient cloning of genes of Neurospora crassa. Proc. Natl. Acad. Sci. USA 83:4869-4873.
43. Volpe, T. A., C. Kidner, I. M. Hall, G. Teng, S. I. Grewal, and R. A. Martienssen. 2002. Regulation of heterochromatic silencing and histone H3 lysine-9 methylation by RNAi. Science 297:1833-1837.
44. Wassenegger, M., S. Heimes, L. Riedel, and H. L. Sanger. 1994. RNA-directed de novo methylation of genomic sequences in plants. Cell 76:567-576.[CrossRef][Medline]
45. Zilberman, D., X. Cao, and S. E. Jacobsen. 2003. ARGONAUTE4 control of locus-specific siRNA accumulation and DNA and histone methylation. Science 299:716-719.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|